English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

A rapid and simple procedure using polymerase chain reaction (PCR) was developed for the detection of cholera enterotoxin (CT) producing character. This method is based on amplifying a 380 base pair (bp) segment of the CT gene (ctx) which controls the production of CT. Two single-stranded oligonucleotides, synthetized to be complementary to the known nucleotide sequences of genes encoding the A-subunit of ctx, were used as extension primers. The oligonucleotide sequences are 5'TCAAACTATATTGTCTGGTC (CT-1) and 5'CGCAAGTATTACTCATCGA (CT-2). As template DNA was used 5 microliter of boiled bacterial culture broth at 95 degrees C for 5 min without the need for DNA extraction. The amplified target DNA were confirmed with only CT producing Vibrio cholerae O1 but not with CT non-producing organisms such as heat labile enterotoxin producing Escherichia coli by electrophoretic analysis of PCR mixture after amplification. A few isolates of CT producing V. mimicus and V. cholerae non-O1 were identified.

Detection of Toxigenic Vibrio cholerae Ol Using Polymerase Chain Reaction for Amplifying the Cholera Enterotoxin Gene