English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid