English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

This study aims to determine the profile of the ABC2 encoding transporter on  Trypanosoma evansi  ( T. evansi ) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing  Trypanosoma evansi  that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples.  Trypanosoma evansi  which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of  T.evansi  have high similarity to ABC Transporters of  T. brucei gambiense ,  T. brucei brucei , and  T. brucei brucei  (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.

bio web of conferences/bio web of conferences

Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi <i>Trypanosoma evansi</i> Isolate that suspected resistance to Isometamidium Chloride

Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride