English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

Landscapes in ecology have a profound influence on the adaption and evolution of competing populations for resources [1]. We are interested in how altruistic populations survive in the presence of selfish individuals in a non-stirred, closed and complex nutrient landscape. Well-stirred (landscape-free) but closed environments have a depressing future when selfish individuals arise in a population, a fate known as the tragedy of the Commons [2]. Over-exploitation of a well-stirred communal habitat by selfish individuals which do not follow rules of communal self-regulation ends up in the elimination (extinction) of both the original altruistic inhabitants and the selfish population. In the context of bacterial population, the Commons tragedy that occurs is the consumption of limited resources by the individuals, resulting in metabolic stressing of the bacteria and growth advantages to be gained by defection from a “social contract” of altruistic cooperation. There is no avoidance of this tragedy and the collapse of an original altruistic wild-type population by an emergent selfish population in a well-stirred but closed environment is inevitable [3, 4]. However, there is a fundamental difference between resource exploitation in a well-stirred homogenous commons and in a heterogenous landscape of nutrients which is not stirred [6]. We show here using a non-stirred nanofabricated habitat landscape that altruists and selfish bacteria can in fact coexist, that they can maintain phenotype diversity and avoid the tragedy of the Commons. This emergent spatial segregation of competing populations under stress greatly changes, we believe, our perception of the true sophistication of bacterial response to stress and competition, and has broad implications for the adaptive strategies of higher organisms under stress in complex environments. Within a bacterial context, the entry into stationary phase of bacteria results in restriction of growth and is an altruist strategy. Wild type bacterial cells have evolved sophisticated cellsignalling networks (quorum sensing [7], chemotaxis [8]) to gauge the proper levels of environmental degradation at which this metabolic transition ought to be induced. The expression of proteins is controlled by promoter selective binding on RNA polymerase which, for E. coli , is controlled by the known σ factors [9]. This gives rise to the possibility of a global switching of gene expression in bacteria via genetically changing the σ factor genes. In particular, there are a set of σ factor genes, rposD and rposS, which are known to be connected to response to external metabolic stresses [10, 11]. In particular, expression of the rpoS gene, which codes for the σ factor of RNA polymerase, gives strains more resistance to external stress but also gives rise to poor substrate metabolic competence, that is, expression of rposS requires the organism to utilize complex molecules typically present when wild-strains die and lyse under stress. Thus, a RpoS mutant might be expected to act as a “cheater” strain if the mutation gives the organism the ability to grow during stationary phase by metabolizing high energy compounds released by the death and lysis of wild-type RpoS bacteria under conditions of stress. The Kolter lab has studied the adaption of E. coli to conditions of prolonged metabolic stress [12] and has found that about 4 days into the stationary phase a mutant strain emerges which has a Growth Advantage in Stationary Phase (GASP), that is, it acts as a “cheater”, and that the mutation is in the rpoS gene [5]. The rpoS819 mutant that we isolated and sequenced has an interesting sequence: it is simply a 48 bp repeat of the adjoining sequence in 2 N at ur e P re ce di ng s : h dl :1 01 01 /n pr e. 20 08 .1 71 3. 1 : P os te d 23 M ar 2 00 8 the rpoS gene, indicating that there is a basic, modular gene sequence insertion used to control the basic GASP phenotype. We constructed fluorescent cheater and cooperator strains of E. coli based upon the rpos819 mutant. The selfish strain (rpoS819) was made by P1 phage transduction from the GASP mutant [12] which was initially the strain W3110 before GASP adapation. The selfish rpoS819 mutants were made identifiable by expression of either a green fluorescent protein (GFP) inserted by P1 phage transduction into the lacYZ operon (lacYZ::GFP2, rpoS819 (green) = JEK1032) or by expression of a red fluorescent protein RFP by construction of W3110 lacYZ::mRFP-1, rpoS819 (red)= JEK1033). Cooperator strains (rpoSwt) carrying the wt allele where also made in a similar fashion: (green) JEK1036 = W3110 lacYZ::GFP?2, rpoSwt (green) and (red) JEK1037 = W3110 lacYZ::mRFP-1, rpoSwt. Since both the altruistic strains (JEK1036, green and JEK1037, red) and the selfish strains (JEK 1033, red and JEK 1032, green) where created we verified in control experiments to ensure that the color channels did not bleed between red and green filter sets. In order to sequence the rpoS locus around the insertion giving rise to the 819 allele, we used a forward primer rpoS-Fwd-Kolter 5-TCACCCGTGAACGTGTTC-3 and reverse primer rpoS-RevKolter 5-GTTAACGACCATTCTCG-3. DNA sequencing of the PCR producs was done using GENEWIZ service to determine the rpoS allele sequence. Sequencing showed that the GASP rpos819 mutant consisted of lateral transfers taken from flanking sequences of the rpoS genome: the first part of the rpoS819 sequence (gcaggggctgaatatcgaa) is actually a lateral transfer of the sequence which follows after the insertion, and the last part of the rpoS819 sequence (gcgccgtttgcgcgaaatcctgcaaac) is a lateral transfer of the rpoS which comes before the insertion. The Supplementary Material shows that the rpoS819 mutation was preserved in JEK1033 and JEK1032, and that the GFP and RFP proteins do not cause differential changes in the growth curves of the bacteria under low stress conditions. Experiments were carried out in a nanofabricated ecological landscape consisting of a row of Micro Habitat patches (MHPs) which were introduced in a previous publication [13]. The MHP array consists of 85 chambers of dimensions 100 by 100 by 10 μm which are interconnected with 5 microns wide junction channels (JCs). Resources can diffuse into the MHPs through 200 nm deep nanoslits (NS) from feeder channels. While the JCs allow the bacteria to move between the MHPs, the NS only allow nutrients (and waste) to diffuse into and out of the MHPs, since they are too thin for E. coli to pass through. There are many variables at play here in the chip design, thus a huge parameter space exists. However, in the experimement presented here, we focus only on the coupling between the feeder channels and the MHPs: a nutrient landscape was created by modifying the number of nanoslits open in each MHP. We made a simple step function to the nutrient landscape, ie. we created regions of perfectly good food access (where all the nanoslits are open)which spans half the microfluidic chip which we call a “white” region, and a region covering the other half where all the nanoslits are closed off, which we call a “black region”. Fig. 1 is a schematic of our rather simple “complex” nutrient landscape device. A fully computer controlled microscope (Nikon Eclipse 90i) equipped with a motorized stage was used to scan the MHP array. Since the two strains JEK1036 and JEK1033 are not only different alleles but also fluoresce in two different spectral regions (green and red, respectively), the separate populations can be distinguished within the MHP chip. The excitation source was a Hg-Xe arc lamp 3 N at ur e P re ce di ng s : h dl :1 01 01 /n pr e. 20 08 .1 71 3. 1 : P os te d 23 M ar 2 00 8

Selfish and Altruistic Bacterial Populations Maximize Fitness Under Stress by Local Segregation