English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

Background: Blastocystis spp. is a unique enteric parasite commonly found in the intestines of humans and animals. In humans, prevalence up to 60% has been reported in tropical, subtropical, and developing countries. Currently 26 subtypes (STs) of Blastocystis have been described based on sequence analysis, 9 were reported in humans. Objectives: The aim of the work was to determine the different genotypes of Blastocystis spp. in symptomatic and asymptomatic individuals in Alexandria city, Egypt. Subjects and Methods: Examination of 100 stool samples was performed to detect Blastocystis collected from patients complaining of gastrointestinal (GI) disturbances and asymptomatic individuals. PCR restriction fragment length polymorphism analysis (PCR-RFLP) and sequencing of amplified products was performed for Blastocystis subtyping. Results: Out of 47 fecal samples positive only for Blastocystis spp. by microscopy, 39 patients presented with symptoms and 8 were asymptomatic participants. Blastocystis small subunit rRNA (SSU rRNA) was successfully amplified from 27 samples; 24/39 symptomatic and 3/8 asymptomatic. Among symptomatic patients, four STs were identified; ST3 was the most common (55%) followed by ST1 (20%), ST4 (15%) and ST2 (10%). While ST2 and ST4 were identified only in patients having GI symptoms, ST1 and ST3 were found in both symptomatic and asymptomatic participants. Amplicons of 7 samples from symptomatic patients were not digested after incubation with the restriction enzymes and could not be genotyped. Conclusion: Genotyping of Blastocystis spp. from fecal samples revealed the presence of four different subtypes: ST1, ST2, ST3 and ST4 with predominance of ST3. No statistically significant association could be observed between Blastocystis STs and clinical presentation of the studied subjects. RFLP analysis of Blastocystis spp. El-Taweel et al., 165 (most prevalent are ST1-5 as well as other rarer STs, ST6-9)[16]. A previous study in Egypt detected ST1 in symptomatic patients and ST2 in asymptomatic persons while ST3 and ST4 were identified in both symptomatic and asymptomatic individuals[17]. Another study showed that ST3 is the most common one in fecal samples collected from Saudi patients with GI complaints[18]. Treatment of Blastocystis is generally recommended in symptomatic patients, regardless the infecting ST, when it is detected in the absence of other detectable enteric pathogens[10]. However, differences in sensitivity of Blastocystis STs to anti-microbial agents were described[19]. Identification of Blastocystis subtypes may, therefore, help in determining the need for treatment and prescription of the appropriate anti-parasitic drug. Moreover, characterization of Blastocystis subtypes may provide a clue for predicting the likely source of infection and understanding the dynamics of transmission[3]. Recent reports on the distribution of Blastocystis subtypes are available from several countries and, in some cases, from different areas of the same country. In a large multi-center study in France, the distribution of Blastocystis subtypes in 141 positive stool samples concluded that most cases are caused by STs 1-4[20]. In a Brazilian rural community, subtyping of isolates from 85 Blastocystis isolates highlighted predominance of ST3 followed by ST1 and ST2 in equal percentages while ST4 and ST8 were less prevalent[21]. In an urban area of the same country, another study showed markedly lower prevalence of ST2 compared to ST3 and ST1 in 64 samples[22]. In Egypt, studies investigating Blastocystis subtypes are limited. Data is only available from Cairo[23,24], Ismailia[17] and El Mansoura[25]. Based on the standard terminology described by Stensvold et al.[26], a total of six STs (STs1-4 and STs 6,7) were identified in the mentioned Egyptian studies with dissimilar relative frequency. The present work aimed to analyze STs of Blastocystis spp.in infected symptomatic and asymptomatic individuals from Alexandria, Egypt using PCR-RFLP analysis. Sequencing of the amplified products was performed on random samples for confirmation. SUBJECTS AND METHODS A cross sectional study was carried out to detect infection with Blastocystis spp. in 100 individuals referred to the Parasitology Laboratory of the Medical Research Institute, Alexandria University for routine parasitological examination during the period between April and August 2017. Subjects with Blastocystis-positive stool samples and with no other detectable parasite were enrolled in the study. Personal information as name, age, gender, and clinical history were recorded. Based on clinical presentation, participants were categorized as 'asymptomatic' if they had no GI symptoms or ‘symptomatic’ if they had any GI complaints such as diarrhea, abdominal pain, nausea, or flatulence. Collection and processing of stool samples: Fresh stool specimens free of water or urine were collected in clean, dry sealed labelled plastic containers. At the Parasitology Department laboratory, each sample was mixed thoroughly and examined for Blastocystis spp. using saline and iodine wet mount smears and formalin ethyl-acetate sedimentation technique[27]. DNA extraction and PCR-RFLP: DNA was extracted from Blastocystis positive fecal samples using the extraction kit Bioline fecal isolate DNA (UK) according to the manufacturer’s instructions[28]. A PCR protocol was used to amplify a region of Blastocystis SSU rRNA gene using the thermal cycler (Beco, Germany); amplification was performed using the forward and reverse primers; RD3 (GGGATCCTGATCCTTCCGCAGGTTCACCTAC) and RD5 (GGGATCCTGATCCTTCCGCAGGTTCACCTAC), respectively[28]. The PCR was carried out in a 50 μl reaction volume containing 10 μl DNA extract, 25 μl DreamTaq® GreenMaster Mix (Fermentas, USA), 1 μl forward primer, 1 μl reverse primer and 13 μl nuclease-free water. The amplification steps included a first cycle of denaturation at 95°C for 3 min, 35 cycles of denaturation at 95°C for 3 min, annealing at 58°C for 30 sec, and extension at 72°C for 2 min, and a final extension step at 72 °C for 5 min. Amplification products and molecular weight marker (100 base pair DNA ladder, Bioron, Germany) were electrophoresed in 0.8% agarose gel stained with ethidium bromide and were visualized under UV transilluminator. Each PCR run included a positive control of a known PCR positive sample approved by sequencing from previous study in the department and a negative control of nuclease-free water[29]. The amplified products for the SSU rRNA gene were digested to determine the strain subtype of Blastocystis spp. using 3 restriction enzymes; Hinfl, Rsal, and Sau3Al[28]. Restriction digestion was performed at 37°C for 15 minutes for the first two enzymes and for one hour for the third one. The total volume of the reaction mix was composed of 25 μl containing 10 μl PCR product, 2.5 μl 10 X buffer, 1 μl restriction enzyme and 11.5 μl sterile nuclease-free water. The restriction fragments were separated by electrophoresis on 2% agarose gel stained with ethidium bromide and visualized with a UV transilluminator. Interpretation of the resulting products of digestion and identification of B. hominis subtypes were performed by comparison to patterns described by Clark[28] and modified according to the consensus terminology described by Stensvold et al.[26]. Sequencing: For confirmation of RFLP typing results, the amplified products of randomly selected samples were sequenced. The amplicon bands were PARASITOLOGISTS UNITED JOURNAL 166 excised, and DNA was extracted using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instruction. DNA sequencing of purified PCR products was performed using the BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Darmstadt, Germany). Nucleotide sequences were determined on an ABI Prism 310 genetic Analyzer (Applied Biosystems, Germany). Sequences obtained in the present study were analyzed and aligned with previously recorded sequences of Blastocystis using standard software BioEdit Version 7.0.5 (Sequence Alignment Editor). Comparison of the identified samples with those accessible in the GenBank Database was held using the BLAST (Basic Local Alignment Search Tool) program located at the databases of the NCBI (National Center for Biotechnology Information, Bethesda, MD, USA) (www.blast.ncbi.nlm.nih.gov/Blast.cgi). Statistical analysis: Data were statistically analyzed using IBM SPSS software package version 20.0. (Armonk, NY: IBM Corp). Chi-square, Fisher’s exact test or Monte Carlo corrections were used to test the association between variables. A P value less than 0.05 was considered statistically significant. Ethical Consideration: The protocol of the study was approved by the Research Ethics Committee of the Medical Research Institute (MRI), Alexandria University (IORG 0008812). An informed consent was obtained from each patient. Infected individuals were referred to a physician for treatment.

Restriction fragment length polymorphism (RFLP) analysis of Blastocystis spp. in symptomatic and asymptomatic individuals from Alexandria, Egypt